Codon Usage Bias Calculator

Use this codon usage bias calculator to analyze the frequency of specific codons within a given DNA or RNA sequence.

Codon usage bias refers to the phenomenon where certain codons are used more frequently than others to encode the same amino acid. This bias can vary significantly between different organisms and even between genes within the same organism.

Consider the amino acid leucine, which is encoded by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG. In E. coli, the codon CUG is used more frequently than the others, while in humans, CUC and CUG are preferred. A codon usage calculator analyze a given sequence and determine the frequency of each codon, helping researchers understand the organism’s preference and optimize gene expression.

Codon Usage Chart

Amino Acid	Codon	Frequency (%)	Properties	Synonymous Codons	Biological Significance
Alanine	GCU	40	Non-polar, hydrophobic	GCU, GCC, GCA, GCG	Important for protein structure and stability.
	GCC	30	Non-polar, hydrophobic		Commonly found in enzymes and structural proteins.
	GCA	20	Non-polar, hydrophobic		Plays a role in metabolic pathways.
	GCG	10	Non-polar, hydrophobic		Involved in the formation of alpha-helices.
Leucine	UUA	10	Non-polar, hydrophobic	UUA, UUG, CUU, CUC, CUA, CUG	Key in protein synthesis and regulation.
	UUG	15	Non-polar, hydrophobic		Often found in muscle proteins.
	CUU	20	Non-polar, hydrophobic		Plays a role in energy metabolism.
	CUC	25	Non-polar, hydrophobic		Important for protein folding.
	CUA	5	Non-polar, hydrophobic		Less frequently used in mammals.
	CUG	25	Non-polar, hydrophobic		Frequently used in yeast and fungi.
Serine	UCU	25	Polar, hydrophilic	UCU, UCC, UCA, UCG, AGU, AGC	Involved in phosphorylation processes.
	UCC	20	Polar, hydrophilic		Important for enzyme activity.
	UCA	15	Polar, hydrophilic		Plays a role in signaling pathways.
	UCG	10	Polar, hydrophilic		Important in protein interactions.
	AGU	15	Polar, hydrophilic		Involved in metabolic regulation.
	AGC	15	Polar, hydrophilic		Plays a role in immune response.
Glycine	GGU	30	Non-polar, flexible	GGU, GGC, GGA, GGG	Provides flexibility in protein structures.
	GGC	25	Non-polar, flexible		Common in collagen and elastin.
	GGA	20	Non-polar, flexible		Important in structural proteins.
	GGG	25	Non-polar, flexible		Plays a role in protein folding.
Aspartic Acid	GAU	30	Polar, acidic	GAU, GAC	Involved in neurotransmission.
	GAC	70	Polar, acidic		Important in metabolic pathways.

Codon Usage Formula

The Relative Synonymous Codon Usage (RSCU) is a common measure of codon usage bias. The formula is:

RSCU = Observed frequency of codon / Expected frequency of codon

Where the expected frequency is calculated as:

Expected frequency = (Total occurrences of the amino acid) / (Number of synonymous codons for that amino acid)

For example, let’s calculate the RSCU for the leucine codon CUG in our organism:

Total occurrences of leucine codons: 100
Number of synonymous codons for leucine: 6

Observed frequency of CUG: 25

Expected frequency = 100 / 6 ≈ 16.67
RSCU = 25 / 16.67 ≈ 1.5

An RSCU value greater than 1 indicates that the codon is used more frequently than expected, while a value less than 1 suggests it’s used less frequently.

Relative Synonymous Codon Usage (RSCU):

RSCU = Observed frequency of codon / Expected frequency if usage was uniform

RSCU = Xij / (1/ni × Yi)

Where:

Xij = frequency of jth codon for ith amino acid
ni = number of alternative codons for ith amino acid
Yi = total frequency of ith amino acid

Codon Adaptation Index (CAI):

CAI = exp(1/L × Σ ln(wi))

Where:

L = number of codons in the gene
wi = relative adaptiveness of the ith codon
exp = exponential function

Effective Number of Codons (ENC):

ENC = 2 + GC3s + (9/Mean(F2)) + (5/Mean(F4))

Where:

GC3s = GC content at third codon position
F2 = frequency of use of two-fold degenerate codons
F4 = frequency of use of four-fold degenerate codons

GC Content at Third Position (GC3):

GC3 = (G3 + C3) / (G3 + C3 + A3 + T3) × 100

Where G3, C3, A3, T3 are the frequencies of these bases at the third position

Frequency of Optimal Codons (Fop):

Fop = Number of optimal codons / Total number of synonymous codons

How to Determine Codon Usage?

To determine codon usage:

Obtain the DNA or RNA sequence of interest.
Count the occurrences of each codon in the sequence.
Calculate the frequency of each codon relative to its synonymous codons.
Compare the frequencies to identify biases.

Let’s analyze a short DNA sequence:

ATGGCTCTGTACGAGCAGCTGCAG

Count codons:
- ATG (1)
- GCT (1)
- CTG (1)
- TAC (1)
- GAG (1)
- CAG (2)
- CTG (1)
Calculate frequencies:
- Methionine (ATG): 100% (only one codon)
- Alanine (GCT): 100% (only one instance)
- Leucine (CTG): 100% (only one instance)
- Tyrosine (TAC): 100% (only one instance)
- Glutamic acid (GAG): 100% (only one instance)
- Glutamine (CAG): 100% (two instances, same codon)

More Biology Tools

Codon Usage Bias Calculator – Calculate Codon Usage